ID: 1138109773

View in Genome Browser
Species Human (GRCh38)
Location 16:54314345-54314367
Sequence AAGCAAGTGCCTTCTTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138109773_1138109774 -7 Left 1138109773 16:54314345-54314367 CCTTGTGAAGAAGGCACTTGCTT No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data
1138109773_1138109777 15 Left 1138109773 16:54314345-54314367 CCTTGTGAAGAAGGCACTTGCTT No data
Right 1138109777 16:54314383-54314405 GCATGATTGTAAGTTTCCTGAGG 0: 64
1: 6181
2: 8450
3: 6746
4: 4304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138109773 Original CRISPR AAGCAAGTGCCTTCTTCACA AGG (reversed) Intergenic
No off target data available for this crispr