ID: 1138109774

View in Genome Browser
Species Human (GRCh38)
Location 16:54314361-54314383
Sequence CTTGCTTCTCCTTCACCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138109767_1138109774 19 Left 1138109767 16:54314319-54314341 CCCTGCTCCCTCTCTCTTTCCTG No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data
1138109772_1138109774 0 Left 1138109772 16:54314338-54314360 CCTGCTACCTTGTGAAGAAGGCA No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data
1138109770_1138109774 11 Left 1138109770 16:54314327-54314349 CCTCTCTCTTTCCTGCTACCTTG No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data
1138109768_1138109774 18 Left 1138109768 16:54314320-54314342 CCTGCTCCCTCTCTCTTTCCTGC No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data
1138109769_1138109774 12 Left 1138109769 16:54314326-54314348 CCCTCTCTCTTTCCTGCTACCTT No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data
1138109766_1138109774 20 Left 1138109766 16:54314318-54314340 CCCCTGCTCCCTCTCTCTTTCCT No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data
1138109773_1138109774 -7 Left 1138109773 16:54314345-54314367 CCTTGTGAAGAAGGCACTTGCTT No data
Right 1138109774 16:54314361-54314383 CTTGCTTCTCCTTCACCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138109774 Original CRISPR CTTGCTTCTCCTTCACCTTC TGG Intergenic
No off target data available for this crispr