ID: 1138122730

View in Genome Browser
Species Human (GRCh38)
Location 16:54413522-54413544
Sequence GATGCATGCTGGATCCTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138122730_1138122738 14 Left 1138122730 16:54413522-54413544 CCCTACAGGATCCAGCATGCATC No data
Right 1138122738 16:54413559-54413581 CCATTGAGGATCTAGGAGGGTGG No data
1138122730_1138122734 7 Left 1138122730 16:54413522-54413544 CCCTACAGGATCCAGCATGCATC No data
Right 1138122734 16:54413552-54413574 TCGTCAGCCATTGAGGATCTAGG No data
1138122730_1138122733 0 Left 1138122730 16:54413522-54413544 CCCTACAGGATCCAGCATGCATC No data
Right 1138122733 16:54413545-54413567 TTGTACATCGTCAGCCATTGAGG No data
1138122730_1138122736 11 Left 1138122730 16:54413522-54413544 CCCTACAGGATCCAGCATGCATC No data
Right 1138122736 16:54413556-54413578 CAGCCATTGAGGATCTAGGAGGG No data
1138122730_1138122735 10 Left 1138122730 16:54413522-54413544 CCCTACAGGATCCAGCATGCATC No data
Right 1138122735 16:54413555-54413577 TCAGCCATTGAGGATCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138122730 Original CRISPR GATGCATGCTGGATCCTGTA GGG (reversed) Intergenic
No off target data available for this crispr