ID: 1138126033

View in Genome Browser
Species Human (GRCh38)
Location 16:54439328-54439350
Sequence GGGGTGATAGAGATAGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138126026_1138126033 7 Left 1138126026 16:54439298-54439320 CCCCTGAAGTTTGATGGAAGCTT No data
Right 1138126033 16:54439328-54439350 GGGGTGATAGAGATAGATCATGG No data
1138126027_1138126033 6 Left 1138126027 16:54439299-54439321 CCCTGAAGTTTGATGGAAGCTTG No data
Right 1138126033 16:54439328-54439350 GGGGTGATAGAGATAGATCATGG No data
1138126028_1138126033 5 Left 1138126028 16:54439300-54439322 CCTGAAGTTTGATGGAAGCTTGG No data
Right 1138126033 16:54439328-54439350 GGGGTGATAGAGATAGATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138126033 Original CRISPR GGGGTGATAGAGATAGATCA TGG Intergenic
No off target data available for this crispr