ID: 1138127591

View in Genome Browser
Species Human (GRCh38)
Location 16:54451818-54451840
Sequence CACTATATGCAGAAAGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138127590_1138127591 5 Left 1138127590 16:54451790-54451812 CCTATGGTGGGAGGAAGAACATG No data
Right 1138127591 16:54451818-54451840 CACTATATGCAGAAAGATGAAGG No data
1138127585_1138127591 26 Left 1138127585 16:54451769-54451791 CCGGATACAAGTGGAGGGTAGCC No data
Right 1138127591 16:54451818-54451840 CACTATATGCAGAAAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138127591 Original CRISPR CACTATATGCAGAAAGATGA AGG Intergenic
No off target data available for this crispr