ID: 1138128068

View in Genome Browser
Species Human (GRCh38)
Location 16:54455088-54455110
Sequence GTAAACACCCTGGCTTCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138128068_1138128074 15 Left 1138128068 16:54455088-54455110 CCTCGTGAAGCCAGGGTGTTTAC No data
Right 1138128074 16:54455126-54455148 GGGAGCTGCGATCTGAACTTGGG No data
1138128068_1138128076 26 Left 1138128068 16:54455088-54455110 CCTCGTGAAGCCAGGGTGTTTAC No data
Right 1138128076 16:54455137-54455159 TCTGAACTTGGGTGTTGTGGCGG No data
1138128068_1138128073 14 Left 1138128068 16:54455088-54455110 CCTCGTGAAGCCAGGGTGTTTAC No data
Right 1138128073 16:54455125-54455147 AGGGAGCTGCGATCTGAACTTGG No data
1138128068_1138128075 23 Left 1138128068 16:54455088-54455110 CCTCGTGAAGCCAGGGTGTTTAC No data
Right 1138128075 16:54455134-54455156 CGATCTGAACTTGGGTGTTGTGG No data
1138128068_1138128070 -6 Left 1138128068 16:54455088-54455110 CCTCGTGAAGCCAGGGTGTTTAC No data
Right 1138128070 16:54455105-54455127 GTTTACTCCAGAGAGAGCACAGG No data
1138128068_1138128071 -5 Left 1138128068 16:54455088-54455110 CCTCGTGAAGCCAGGGTGTTTAC No data
Right 1138128071 16:54455106-54455128 TTTACTCCAGAGAGAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138128068 Original CRISPR GTAAACACCCTGGCTTCACG AGG (reversed) Intergenic
No off target data available for this crispr