ID: 1138131423

View in Genome Browser
Species Human (GRCh38)
Location 16:54483058-54483080
Sequence TCACAATAGGTCCGCAGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138131418_1138131423 16 Left 1138131418 16:54483019-54483041 CCGACCACAGAGAAGAGATGCCA No data
Right 1138131423 16:54483058-54483080 TCACAATAGGTCCGCAGTACAGG No data
1138131420_1138131423 -4 Left 1138131420 16:54483039-54483061 CCAGAGATTAGCAGTTACCTCAC No data
Right 1138131423 16:54483058-54483080 TCACAATAGGTCCGCAGTACAGG No data
1138131419_1138131423 12 Left 1138131419 16:54483023-54483045 CCACAGAGAAGAGATGCCAGAGA No data
Right 1138131423 16:54483058-54483080 TCACAATAGGTCCGCAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138131423 Original CRISPR TCACAATAGGTCCGCAGTAC AGG Intergenic
No off target data available for this crispr