ID: 1138133075

View in Genome Browser
Species Human (GRCh38)
Location 16:54498833-54498855
Sequence ATAAATCCTCAGATGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138133070_1138133075 17 Left 1138133070 16:54498793-54498815 CCTAAGGAATTCTATTCCTCTAG No data
Right 1138133075 16:54498833-54498855 ATAAATCCTCAGATGGTGCAAGG No data
1138133072_1138133075 1 Left 1138133072 16:54498809-54498831 CCTCTAGGAAATGTTTCCTAACA No data
Right 1138133075 16:54498833-54498855 ATAAATCCTCAGATGGTGCAAGG No data
1138133069_1138133075 18 Left 1138133069 16:54498792-54498814 CCCTAAGGAATTCTATTCCTCTA No data
Right 1138133075 16:54498833-54498855 ATAAATCCTCAGATGGTGCAAGG No data
1138133068_1138133075 27 Left 1138133068 16:54498783-54498805 CCGCACTCTCCCTAAGGAATTCT No data
Right 1138133075 16:54498833-54498855 ATAAATCCTCAGATGGTGCAAGG No data
1138133067_1138133075 28 Left 1138133067 16:54498782-54498804 CCCGCACTCTCCCTAAGGAATTC No data
Right 1138133075 16:54498833-54498855 ATAAATCCTCAGATGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138133075 Original CRISPR ATAAATCCTCAGATGGTGCA AGG Intergenic
No off target data available for this crispr