ID: 1138137160

View in Genome Browser
Species Human (GRCh38)
Location 16:54533060-54533082
Sequence CAGGGGCTAGGTAGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138137155_1138137160 -6 Left 1138137155 16:54533043-54533065 CCAGTCTACATTCACATCAGGGG No data
Right 1138137160 16:54533060-54533082 CAGGGGCTAGGTAGGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138137160 Original CRISPR CAGGGGCTAGGTAGGGAAAC AGG Intergenic
No off target data available for this crispr