ID: 1138139214

View in Genome Browser
Species Human (GRCh38)
Location 16:54552884-54552906
Sequence GATCTTAACTCCCTGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138139214_1138139224 0 Left 1138139214 16:54552884-54552906 CCCCAGCCCAGGGAGTTAAGATC No data
Right 1138139224 16:54552907-54552929 TCAGCCCTGGGGAGTTGGGTAGG No data
1138139214_1138139225 1 Left 1138139214 16:54552884-54552906 CCCCAGCCCAGGGAGTTAAGATC No data
Right 1138139225 16:54552908-54552930 CAGCCCTGGGGAGTTGGGTAGGG No data
1138139214_1138139223 -4 Left 1138139214 16:54552884-54552906 CCCCAGCCCAGGGAGTTAAGATC No data
Right 1138139223 16:54552903-54552925 GATCTCAGCCCTGGGGAGTTGGG No data
1138139214_1138139222 -5 Left 1138139214 16:54552884-54552906 CCCCAGCCCAGGGAGTTAAGATC No data
Right 1138139222 16:54552902-54552924 AGATCTCAGCCCTGGGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138139214 Original CRISPR GATCTTAACTCCCTGGGCTG GGG (reversed) Intergenic
No off target data available for this crispr