ID: 1138139987 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 16:54559801-54559823 |
| Sequence | CCTCATCTGTAAAATGGGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2830 | |||
| Summary | {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1138139987_1138139993 | -4 | Left | 1138139987 | 16:54559801-54559823 | CCATCCCCATTTTACAGATGAGG | 0: 15 1: 99 2: 349 3: 811 4: 1556 |
||
| Right | 1138139993 | 16:54559820-54559842 | GAGGAAACCAAGGCTCAGAGAGG | 0: 37 1: 202 2: 1047 3: 3479 4: 7738 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1138139987 | Original CRISPR | CCTCATCTGTAAAATGGGGA TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||