ID: 1138139987

View in Genome Browser
Species Human (GRCh38)
Location 16:54559801-54559823
Sequence CCTCATCTGTAAAATGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2830
Summary {0: 15, 1: 99, 2: 349, 3: 811, 4: 1556}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138139987_1138139993 -4 Left 1138139987 16:54559801-54559823 CCATCCCCATTTTACAGATGAGG 0: 15
1: 99
2: 349
3: 811
4: 1556
Right 1138139993 16:54559820-54559842 GAGGAAACCAAGGCTCAGAGAGG 0: 37
1: 202
2: 1047
3: 3479
4: 7738

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138139987 Original CRISPR CCTCATCTGTAAAATGGGGA TGG (reversed) Intergenic
Too many off-targets to display for this crispr