ID: 1138140555

View in Genome Browser
Species Human (GRCh38)
Location 16:54564799-54564821
Sequence ATGAGCTGGTGGAAATGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138140555_1138140557 -10 Left 1138140555 16:54564799-54564821 CCTTCACATTTCCACCAGCTCAT No data
Right 1138140557 16:54564812-54564834 ACCAGCTCATCACCCCTCAGAGG No data
1138140555_1138140562 10 Left 1138140555 16:54564799-54564821 CCTTCACATTTCCACCAGCTCAT No data
Right 1138140562 16:54564832-54564854 AGGCAAGCCACCAAGCACTCCGG No data
1138140555_1138140563 11 Left 1138140555 16:54564799-54564821 CCTTCACATTTCCACCAGCTCAT No data
Right 1138140563 16:54564833-54564855 GGCAAGCCACCAAGCACTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138140555 Original CRISPR ATGAGCTGGTGGAAATGTGA AGG (reversed) Intergenic
No off target data available for this crispr