ID: 1138140557

View in Genome Browser
Species Human (GRCh38)
Location 16:54564812-54564834
Sequence ACCAGCTCATCACCCCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138140554_1138140557 4 Left 1138140554 16:54564785-54564807 CCAGTTCTCTCTCTCCTTCACAT No data
Right 1138140557 16:54564812-54564834 ACCAGCTCATCACCCCTCAGAGG No data
1138140555_1138140557 -10 Left 1138140555 16:54564799-54564821 CCTTCACATTTCCACCAGCTCAT No data
Right 1138140557 16:54564812-54564834 ACCAGCTCATCACCCCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138140557 Original CRISPR ACCAGCTCATCACCCCTCAG AGG Intergenic
No off target data available for this crispr