ID: 1138140563

View in Genome Browser
Species Human (GRCh38)
Location 16:54564833-54564855
Sequence GGCAAGCCACCAAGCACTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138140555_1138140563 11 Left 1138140555 16:54564799-54564821 CCTTCACATTTCCACCAGCTCAT No data
Right 1138140563 16:54564833-54564855 GGCAAGCCACCAAGCACTCCGGG No data
1138140556_1138140563 0 Left 1138140556 16:54564810-54564832 CCACCAGCTCATCACCCCTCAGA No data
Right 1138140563 16:54564833-54564855 GGCAAGCCACCAAGCACTCCGGG No data
1138140554_1138140563 25 Left 1138140554 16:54564785-54564807 CCAGTTCTCTCTCTCCTTCACAT No data
Right 1138140563 16:54564833-54564855 GGCAAGCCACCAAGCACTCCGGG No data
1138140558_1138140563 -3 Left 1138140558 16:54564813-54564835 CCAGCTCATCACCCCTCAGAGGC No data
Right 1138140563 16:54564833-54564855 GGCAAGCCACCAAGCACTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138140563 Original CRISPR GGCAAGCCACCAAGCACTCC GGG Intergenic
No off target data available for this crispr