ID: 1138142436

View in Genome Browser
Species Human (GRCh38)
Location 16:54580454-54580476
Sequence CTTTAGACAAAGACTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138142436_1138142441 0 Left 1138142436 16:54580454-54580476 CCCACCTCAGTCTTTGTCTAAAG No data
Right 1138142441 16:54580477-54580499 GTGGAATCCCACAGTCTCTGAGG No data
1138142436_1138142443 7 Left 1138142436 16:54580454-54580476 CCCACCTCAGTCTTTGTCTAAAG No data
Right 1138142443 16:54580484-54580506 CCCACAGTCTCTGAGGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138142436 Original CRISPR CTTTAGACAAAGACTGAGGT GGG (reversed) Intergenic
No off target data available for this crispr