ID: 1138142891

View in Genome Browser
Species Human (GRCh38)
Location 16:54583648-54583670
Sequence TATTAAGAAAAGAAAGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138142888_1138142891 28 Left 1138142888 16:54583597-54583619 CCGGCAAGAAAGCATACAAGGCG No data
Right 1138142891 16:54583648-54583670 TATTAAGAAAAGAAAGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138142891 Original CRISPR TATTAAGAAAAGAAAGTGGT GGG Intergenic
No off target data available for this crispr