ID: 1138148870

View in Genome Browser
Species Human (GRCh38)
Location 16:54636992-54637014
Sequence CTGGACAAAGGATCTTTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138148870_1138148879 24 Left 1138148870 16:54636992-54637014 CCTAAGAAAGATCCTTTGTCCAG No data
Right 1138148879 16:54637039-54637061 GCCTGTCTCCTTCCAATCTTAGG No data
1138148870_1138148876 0 Left 1138148870 16:54636992-54637014 CCTAAGAAAGATCCTTTGTCCAG No data
Right 1138148876 16:54637015-54637037 GCTTGAATCTCTGGTCATCTGGG No data
1138148870_1138148877 1 Left 1138148870 16:54636992-54637014 CCTAAGAAAGATCCTTTGTCCAG No data
Right 1138148877 16:54637016-54637038 CTTGAATCTCTGGTCATCTGGGG No data
1138148870_1138148881 25 Left 1138148870 16:54636992-54637014 CCTAAGAAAGATCCTTTGTCCAG No data
Right 1138148881 16:54637040-54637062 CCTGTCTCCTTCCAATCTTAGGG No data
1138148870_1138148875 -1 Left 1138148870 16:54636992-54637014 CCTAAGAAAGATCCTTTGTCCAG No data
Right 1138148875 16:54637014-54637036 GGCTTGAATCTCTGGTCATCTGG No data
1138148870_1138148873 -9 Left 1138148870 16:54636992-54637014 CCTAAGAAAGATCCTTTGTCCAG No data
Right 1138148873 16:54637006-54637028 TTTGTCCAGGCTTGAATCTCTGG No data
1138148870_1138148878 2 Left 1138148870 16:54636992-54637014 CCTAAGAAAGATCCTTTGTCCAG No data
Right 1138148878 16:54637017-54637039 TTGAATCTCTGGTCATCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138148870 Original CRISPR CTGGACAAAGGATCTTTCTT AGG (reversed) Intergenic
No off target data available for this crispr