ID: 1138154793

View in Genome Browser
Species Human (GRCh38)
Location 16:54693204-54693226
Sequence TTGCAAATTGCAGTGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138154793_1138154800 3 Left 1138154793 16:54693204-54693226 CCCTCCACCACTGCAATTTGCAA No data
Right 1138154800 16:54693230-54693252 CCCAAAGGAGCCTGGTCCTCAGG No data
1138154793_1138154798 -5 Left 1138154793 16:54693204-54693226 CCCTCCACCACTGCAATTTGCAA No data
Right 1138154798 16:54693222-54693244 TGCAATGTCCCAAAGGAGCCTGG No data
1138154793_1138154802 4 Left 1138154793 16:54693204-54693226 CCCTCCACCACTGCAATTTGCAA No data
Right 1138154802 16:54693231-54693253 CCAAAGGAGCCTGGTCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138154793 Original CRISPR TTGCAAATTGCAGTGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr