ID: 1138157626

View in Genome Browser
Species Human (GRCh38)
Location 16:54720712-54720734
Sequence TGCCATCCATGCCTGCACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138157626_1138157631 -2 Left 1138157626 16:54720712-54720734 CCCATGTGCAGGCATGGATGGCA No data
Right 1138157631 16:54720733-54720755 CAGGGAACAGGACACAGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138157626 Original CRISPR TGCCATCCATGCCTGCACAT GGG (reversed) Intergenic
No off target data available for this crispr