ID: 1138170108

View in Genome Browser
Species Human (GRCh38)
Location 16:54840918-54840940
Sequence GCACTCAGTAAATATAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138170108_1138170113 17 Left 1138170108 16:54840918-54840940 CCCAGTTTATATTTACTGAGTGC No data
Right 1138170113 16:54840958-54840980 TACTGCACTAGGTGCTTTTCAGG No data
1138170108_1138170114 23 Left 1138170108 16:54840918-54840940 CCCAGTTTATATTTACTGAGTGC No data
Right 1138170114 16:54840964-54840986 ACTAGGTGCTTTTCAGGCACAGG No data
1138170108_1138170110 6 Left 1138170108 16:54840918-54840940 CCCAGTTTATATTTACTGAGTGC No data
Right 1138170110 16:54840947-54840969 TCCATGCCATCTACTGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138170108 Original CRISPR GCACTCAGTAAATATAAACT GGG (reversed) Intergenic
No off target data available for this crispr