ID: 1138173077

View in Genome Browser
Species Human (GRCh38)
Location 16:54871250-54871272
Sequence TCCGGTCATTTAAAAGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138173077_1138173081 19 Left 1138173077 16:54871250-54871272 CCACACACTTTTAAATGACCGGA No data
Right 1138173081 16:54871292-54871314 TGATCACCAAGACAATGCCAAGG No data
1138173077_1138173084 26 Left 1138173077 16:54871250-54871272 CCACACACTTTTAAATGACCGGA No data
Right 1138173084 16:54871299-54871321 CAAGACAATGCCAAGGGCGATGG No data
1138173077_1138173082 20 Left 1138173077 16:54871250-54871272 CCACACACTTTTAAATGACCGGA No data
Right 1138173082 16:54871293-54871315 GATCACCAAGACAATGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138173077 Original CRISPR TCCGGTCATTTAAAAGTGTG TGG (reversed) Intergenic
No off target data available for this crispr