ID: 1138173080

View in Genome Browser
Species Human (GRCh38)
Location 16:54871277-54871299
Sequence GGTGATCATGAGTGAATTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138173080_1138173084 -1 Left 1138173080 16:54871277-54871299 CCGATAATTCACTCATGATCACC No data
Right 1138173084 16:54871299-54871321 CAAGACAATGCCAAGGGCGATGG No data
1138173080_1138173086 19 Left 1138173080 16:54871277-54871299 CCGATAATTCACTCATGATCACC No data
Right 1138173086 16:54871319-54871341 TGGTGCTAAACCATTCATGAAGG 0: 113
1: 307
2: 448
3: 495
4: 1008
1138173080_1138173081 -8 Left 1138173080 16:54871277-54871299 CCGATAATTCACTCATGATCACC No data
Right 1138173081 16:54871292-54871314 TGATCACCAAGACAATGCCAAGG No data
1138173080_1138173082 -7 Left 1138173080 16:54871277-54871299 CCGATAATTCACTCATGATCACC No data
Right 1138173082 16:54871293-54871315 GATCACCAAGACAATGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138173080 Original CRISPR GGTGATCATGAGTGAATTAT CGG (reversed) Intergenic
No off target data available for this crispr