ID: 1138173082

View in Genome Browser
Species Human (GRCh38)
Location 16:54871293-54871315
Sequence GATCACCAAGACAATGCCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138173079_1138173082 -6 Left 1138173079 16:54871276-54871298 CCCGATAATTCACTCATGATCAC No data
Right 1138173082 16:54871293-54871315 GATCACCAAGACAATGCCAAGGG No data
1138173077_1138173082 20 Left 1138173077 16:54871250-54871272 CCACACACTTTTAAATGACCGGA No data
Right 1138173082 16:54871293-54871315 GATCACCAAGACAATGCCAAGGG No data
1138173078_1138173082 2 Left 1138173078 16:54871268-54871290 CCGGATCTCCCGATAATTCACTC No data
Right 1138173082 16:54871293-54871315 GATCACCAAGACAATGCCAAGGG No data
1138173080_1138173082 -7 Left 1138173080 16:54871277-54871299 CCGATAATTCACTCATGATCACC No data
Right 1138173082 16:54871293-54871315 GATCACCAAGACAATGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138173082 Original CRISPR GATCACCAAGACAATGCCAA GGG Intergenic
No off target data available for this crispr