ID: 1138173086

View in Genome Browser
Species Human (GRCh38)
Location 16:54871319-54871341
Sequence TGGTGCTAAACCATTCATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2371
Summary {0: 113, 1: 307, 2: 448, 3: 495, 4: 1008}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138173083_1138173086 -2 Left 1138173083 16:54871298-54871320 CCAAGACAATGCCAAGGGCGATG No data
Right 1138173086 16:54871319-54871341 TGGTGCTAAACCATTCATGAAGG 0: 113
1: 307
2: 448
3: 495
4: 1008
1138173079_1138173086 20 Left 1138173079 16:54871276-54871298 CCCGATAATTCACTCATGATCAC No data
Right 1138173086 16:54871319-54871341 TGGTGCTAAACCATTCATGAAGG 0: 113
1: 307
2: 448
3: 495
4: 1008
1138173080_1138173086 19 Left 1138173080 16:54871277-54871299 CCGATAATTCACTCATGATCACC No data
Right 1138173086 16:54871319-54871341 TGGTGCTAAACCATTCATGAAGG 0: 113
1: 307
2: 448
3: 495
4: 1008
1138173078_1138173086 28 Left 1138173078 16:54871268-54871290 CCGGATCTCCCGATAATTCACTC No data
Right 1138173086 16:54871319-54871341 TGGTGCTAAACCATTCATGAAGG 0: 113
1: 307
2: 448
3: 495
4: 1008

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138173086 Original CRISPR TGGTGCTAAACCATTCATGA AGG Intergenic
Too many off-targets to display for this crispr