ID: 1138174968

View in Genome Browser
Species Human (GRCh38)
Location 16:54888823-54888845
Sequence CAGGCAGGAAGGTAGGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138174962_1138174968 5 Left 1138174962 16:54888795-54888817 CCTTCAAATTGTTAGCAAAAGTG No data
Right 1138174968 16:54888823-54888845 CAGGCAGGAAGGTAGGACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138174968 Original CRISPR CAGGCAGGAAGGTAGGACAG AGG Intergenic
No off target data available for this crispr