ID: 1138175486

View in Genome Browser
Species Human (GRCh38)
Location 16:54894259-54894281
Sequence GCCCGATGGCTCCCCTATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138175482_1138175486 -3 Left 1138175482 16:54894239-54894261 CCTTAGTTCCCAGACTCAAGGCC No data
Right 1138175486 16:54894259-54894281 GCCCGATGGCTCCCCTATCCTGG No data
1138175481_1138175486 -2 Left 1138175481 16:54894238-54894260 CCCTTAGTTCCCAGACTCAAGGC No data
Right 1138175486 16:54894259-54894281 GCCCGATGGCTCCCCTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138175486 Original CRISPR GCCCGATGGCTCCCCTATCC TGG Intergenic