ID: 1138175639

View in Genome Browser
Species Human (GRCh38)
Location 16:54895916-54895938
Sequence ATGTTTGCCTTTAATGTCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138175638_1138175639 -9 Left 1138175638 16:54895902-54895924 CCAAAGAAGTGGACATGTTTGCC No data
Right 1138175639 16:54895916-54895938 ATGTTTGCCTTTAATGTCTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138175639 Original CRISPR ATGTTTGCCTTTAATGTCTA CGG Intergenic
No off target data available for this crispr