ID: 1138176973

View in Genome Browser
Species Human (GRCh38)
Location 16:54909390-54909412
Sequence GCTGATGGTGGAACAGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138176968_1138176973 -2 Left 1138176968 16:54909369-54909391 CCAGCCCTTTGTTCAAGTATCGC No data
Right 1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG No data
1138176970_1138176973 -7 Left 1138176970 16:54909374-54909396 CCTTTGTTCAAGTATCGCTGATG No data
Right 1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG No data
1138176969_1138176973 -6 Left 1138176969 16:54909373-54909395 CCCTTTGTTCAAGTATCGCTGAT No data
Right 1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG No data
1138176963_1138176973 14 Left 1138176963 16:54909353-54909375 CCTCAACCCTGGGTCCCCAGCCC No data
Right 1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG No data
1138176965_1138176973 7 Left 1138176965 16:54909360-54909382 CCTGGGTCCCCAGCCCTTTGTTC No data
Right 1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG No data
1138176967_1138176973 -1 Left 1138176967 16:54909368-54909390 CCCAGCCCTTTGTTCAAGTATCG No data
Right 1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG No data
1138176964_1138176973 8 Left 1138176964 16:54909359-54909381 CCCTGGGTCCCCAGCCCTTTGTT No data
Right 1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG No data
1138176966_1138176973 0 Left 1138176966 16:54909367-54909389 CCCCAGCCCTTTGTTCAAGTATC No data
Right 1138176973 16:54909390-54909412 GCTGATGGTGGAACAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138176973 Original CRISPR GCTGATGGTGGAACAGACCC AGG Intergenic
No off target data available for this crispr