ID: 1138178718

View in Genome Browser
Species Human (GRCh38)
Location 16:54928827-54928849
Sequence CCGCGCGCGCCGCCCGCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 327
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 273}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138178718_1138178729 10 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178729 16:54928860-54928882 ACCGTTAGCGCCAGGGGCTGCGG 0: 1
1: 0
2: 1
3: 17
4: 100
1138178718_1138178736 29 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178736 16:54928879-54928901 GCGGCTGCGGCGGGCGGAGCCGG 0: 1
1: 0
2: 30
3: 188
4: 1334
1138178718_1138178735 23 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178735 16:54928873-54928895 GGGGCTGCGGCTGCGGCGGGCGG 0: 1
1: 0
2: 24
3: 266
4: 1690
1138178718_1138178732 19 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178732 16:54928869-54928891 GCCAGGGGCTGCGGCTGCGGCGG 0: 1
1: 0
2: 3
3: 145
4: 1310
1138178718_1138178726 3 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178726 16:54928853-54928875 GTTACCGACCGTTAGCGCCAGGG 0: 1
1: 0
2: 0
3: 2
4: 6
1138178718_1138178725 2 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178725 16:54928852-54928874 CGTTACCGACCGTTAGCGCCAGG 0: 1
1: 0
2: 0
3: 0
4: 5
1138178718_1138178737 30 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178737 16:54928880-54928902 CGGCTGCGGCGGGCGGAGCCGGG 0: 1
1: 1
2: 7
3: 83
4: 630
1138178718_1138178734 20 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178734 16:54928870-54928892 CCAGGGGCTGCGGCTGCGGCGGG 0: 1
1: 1
2: 14
3: 147
4: 1540
1138178718_1138178727 4 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178727 16:54928854-54928876 TTACCGACCGTTAGCGCCAGGGG 0: 1
1: 0
2: 0
3: 0
4: 7
1138178718_1138178731 16 Left 1138178718 16:54928827-54928849 CCCCCGGCGGGCGGCGCGCGCGG 0: 1
1: 0
2: 5
3: 48
4: 273
Right 1138178731 16:54928866-54928888 AGCGCCAGGGGCTGCGGCTGCGG 0: 1
1: 1
2: 3
3: 69
4: 1004

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138178718 Original CRISPR CCGCGCGCGCCGCCCGCCGG GGG (reversed) Intergenic
900314430 1:2050044-2050066 CGGCGCGCGCTGCCAGCCCGAGG - Intergenic
901022155 1:6260976-6260998 CGGAGCGCGCCGGCCGCCGGTGG - Intergenic
901084638 1:6603014-6603036 CCCCGCGCGGCGCCCGCCCCCGG + Intronic
903334665 1:22616898-22616920 CTGCCTGCCCCGCCCGCCGGGGG + Intergenic
903398349 1:23019792-23019814 CCGCGGGCCTCGCCCCCCGGGGG + Exonic
904618602 1:31762891-31762913 CCGGGCGCCCCTCCCCCCGGCGG + Intronic
905037995 1:34929808-34929830 CCGAGGTCGCCGCCCGCGGGCGG + Intergenic
905947793 1:41918192-41918214 CAGCGCGCTCAGCCCACCGGGGG + Intronic
906627143 1:47334269-47334291 CCCGGCACGCCGCGCGCCGGCGG - Intronic
907689228 1:56645559-56645581 CCGAGCCCCGCGCCCGCCGGAGG - Intronic
908473972 1:64470704-64470726 CCGCGCCCGGAGCCCGTCGGCGG + Intergenic
909475225 1:76074647-76074669 CCGCGCGGGCCGCGGGCCAGTGG + Intergenic
910277564 1:85465093-85465115 CAGCGCGCGCTGCCCGCGGCAGG - Exonic
914824571 1:151132143-151132165 CAGCGCGCGCGGCCCGCCCGGGG + Exonic
915519919 1:156436174-156436196 CTCCGCGCGCTGCCCGCCGCCGG + Intergenic
916694597 1:167221894-167221916 GCCCGCGCGCCCCCGGCCGGCGG + Intronic
917797532 1:178542749-178542771 CAGCGCGCGGGGCCCGGCGGGGG - Intronic
918174367 1:182029978-182030000 CCGCCCGCCCCGCCCCCCGGGGG - Intergenic
921172099 1:212558979-212559001 ACGTGCGCGCGGCCCGGCGGGGG + Intergenic
922287623 1:224183553-224183575 CCGCTCGGGCCGCCAGCCCGCGG + Intronic
922502873 1:226110021-226110043 CCGGGCGCGCGGCCGGGCGGGGG + Intergenic
922730743 1:227947763-227947785 CAGTGCGCGCCGGCCGCCGAAGG + Intronic
922937847 1:229434778-229434800 GCGCGCCCTCCGGCCGCCGGTGG - Intergenic
922958531 1:229625752-229625774 CCACCCCCACCGCCCGCCGGCGG + Intronic
924362345 1:243254922-243254944 ACTCGGGCGCCGCCCGCCGCGGG - Intronic
1068955987 10:62818866-62818888 TGGCGCGCGGCGACCGCCGGCGG - Intronic
1072151783 10:92690001-92690023 CGGCGCCCGCCGCCGGCCCGGGG - Exonic
1072491012 10:95906080-95906102 CCGCGCCCCCCGCCCCCCAGAGG - Intronic
1073441445 10:103555181-103555203 ACGCGCACGCCGCCCGCCCGCGG - Intronic
1077914710 11:6603755-6603777 CCGCGCCCGCAGCCCGCCGCCGG - Intronic
1079126374 11:17720918-17720940 CCCCGAGCGGCGCCCGGCGGCGG + Exonic
1079237159 11:18699034-18699056 CAGCGCCCGCCTCCCGCCGCGGG - Intronic
1080628546 11:34052232-34052254 GCGCGCGCGCGACCCGCCAGCGG - Intronic
1081831458 11:46119869-46119891 CCGCGCGCCCCTCCCCCCGGCGG + Intronic
1081872992 11:46391677-46391699 CCGCCCGCCCCGCCGGCCCGCGG - Intergenic
1081938065 11:46918384-46918406 CCGCCCGCGCCGCTCGCCCGGGG + Exonic
1083039121 11:59669068-59669090 CCCCGCTCGGCGCCCGGCGGCGG + Intergenic
1083457246 11:62787238-62787260 CCAGCCGCCCCGCCCGCCGGTGG + Exonic
1083637515 11:64128536-64128558 CCTGGCACGCCGCCCGCCTGAGG + Intronic
1083657078 11:64234806-64234828 CCGCCGGGGCCGCCCGCCGGGGG - Exonic
1083849024 11:65354766-65354788 CCGTGCGCGCCGCCCGCGCCGGG - Exonic
1083941646 11:65899509-65899531 CGGCGCCCGCTGCCCGCCGGGGG - Intronic
1084128697 11:67118209-67118231 GCGCGCCCACCGCCGGCCGGAGG - Intergenic
1084412093 11:69011149-69011171 CCGCGCACTCCTCCCGCCCGGGG + Intronic
1085416527 11:76322126-76322148 CCGCACGCGCCGACCCCCGCCGG - Intergenic
1085666146 11:78417448-78417470 CCGCCCGCCCCGCCCCTCGGCGG + Intronic
1086064905 11:82733806-82733828 CCGCGCGCGCCGCGCCGGGGCGG - Exonic
1086337136 11:85811186-85811208 CCCACCGCACCGCCCGCCGGGGG - Intergenic
1087117814 11:94543859-94543881 CCGCCAGCGACGCCCGCCGGAGG - Exonic
1088173181 11:107019154-107019176 CCGCGCACCCCGCCCGGCTGAGG - Intergenic
1088869015 11:113875610-113875632 CCGCCCGCAGCGCGCGCCGGAGG + Intergenic
1089729507 11:120511630-120511652 CCCCGCGCACGGCCGGCCGGGGG - Intergenic
1089966161 11:122656247-122656269 CCGCGCGCGCGGCCGGCCCTCGG + Intronic
1090832351 11:130428257-130428279 CCGCCCCCGCCGCCCCCCGGTGG - Exonic
1091616181 12:2052882-2052904 CCGCCCGCCCGGCGCGCCGGAGG - Intronic
1095206160 12:39442890-39442912 CGCCGCCCGCCGCCCGCCGCCGG + Intronic
1095440743 12:42237560-42237582 CCCCTCGCGCCGCCGGCCGGCGG - Intronic
1096241182 12:49961305-49961327 CCGCCCGCCCCCGCCGCCGGCGG + Intergenic
1096389585 12:51218086-51218108 CCGCCCGCGCCAGCCGCCGGGGG + Intergenic
1097891372 12:64780822-64780844 CCCCGGGCGGCCCCCGCCGGTGG - Intergenic
1098255379 12:68610841-68610863 CCGCGCGCCCCGCCCGCGGGCGG + Exonic
1100391456 12:94148936-94148958 CCGCGCGCCCTGCCCGGGGGCGG + Exonic
1102025800 12:109713883-109713905 CTGCGCGCGCCGGCCGGGGGAGG + Intergenic
1102056518 12:109900475-109900497 CCGCCCGCGCGGGCCGCCTGCGG - Intronic
1102197406 12:111034839-111034861 CCGGACGCGCCGCCACCCGGGGG + Intronic
1103509729 12:121466607-121466629 GCGCGCCCGCCGCCCGCCGTGGG - Intronic
1104977738 12:132559860-132559882 CCGCGCCCGCCGCCGGCCCGGGG - Intronic
1105000423 12:132687092-132687114 CGGCGCGCCCCGACCGCCGACGG - Intronic
1105240894 13:18609246-18609268 CCGCGCCGGCCGCCTCCCGGTGG + Intergenic
1106242877 13:27924564-27924586 CCGCCGCCGCCGCCCCCCGGAGG + Exonic
1107770733 13:43786252-43786274 CCGGGGGCGACGCCCGCAGGGGG + Intronic
1108408373 13:50125685-50125707 GCGCGCCAGCCGCCCGCCCGCGG + Intronic
1112344366 13:98577320-98577342 CCGGCCCCGCCGCCCGCCCGCGG - Intronic
1113379093 13:109786697-109786719 CCGAGCGCGCCGTCCGTCGGGGG - Intergenic
1113546229 13:111153474-111153496 CCGCGCGCGGGGCCAACCGGTGG + Intronic
1113768371 13:112894419-112894441 CCGCGCGCACCTGCCGCCCGTGG - Intronic
1113831200 13:113297168-113297190 GCGCGCGCGTCGAGCGCCGGCGG - Intergenic
1113914837 13:113863968-113863990 CCGCGGGCGCCGCGGGGCGGAGG + Exonic
1116919848 14:50560776-50560798 CGCCGCCCGCCGCCCGCCGCCGG - Intronic
1118220714 14:63852927-63852949 CCCCGCCCGCCGCCCGCCTCCGG - Intergenic
1118809008 14:69260391-69260413 CTGCGCGCCCCGGCCGCCGGAGG - Exonic
1119046299 14:71321021-71321043 CCGCGCTCGGCGCCCGCCTCGGG + Intronic
1120905686 14:89619167-89619189 CTGCGCCCGGCGCCCGCCCGGGG + Intergenic
1121422511 14:93825222-93825244 CCGCGGGCGCCCCCCTCCTGGGG - Intergenic
1122130708 14:99603373-99603395 CCGGGCGCGCCACCCGACAGCGG + Exonic
1122208464 14:100159931-100159953 CTGCGCGCCCCGCCCACCCGCGG + Exonic
1122543373 14:102509718-102509740 CGCCGCCCGCCGCCCGCCGCCGG - Exonic
1123004696 14:105315457-105315479 CTGCGCGCCCCGTGCGCCGGGGG - Exonic
1123490463 15:20775893-20775915 CCGCGCCGGCCGCCTCCCGGTGG - Intergenic
1123546964 15:21344980-21345002 CCGCGCCGGCCGCCTCCCGGTGG - Intergenic
1124323632 15:28737840-28737862 CGGCGCGCGCCGGCAGCCAGCGG + Intronic
1124500756 15:30225162-30225184 CCTCGTGCGCCGCCCGCCCCCGG + Intergenic
1124742814 15:32313505-32313527 CCTCGTGCGCCGCCCGCCCCCGG - Intergenic
1126348358 15:47718829-47718851 CCGCTCGCGCCGGCAGCCGCTGG + Exonic
1128528912 15:68431209-68431231 CCGCGCGCCCCTCGGGCCGGAGG + Intronic
1128743177 15:70097021-70097043 CCGCGCCCGCCGCCCGGCCCCGG - Exonic
1129503209 15:76059802-76059824 GCGCGCGCGCGGCCGGCGGGAGG + Intergenic
1129710750 15:77819275-77819297 CCGGGCGCGCCGTCCGCGCGCGG + Intronic
1131493511 15:92882892-92882914 CCGCGAGGCCCGCCGGCCGGCGG + Intergenic
1131517612 15:93089322-93089344 CCGCGCGCGCCCCCCGCCCGCGG - Intergenic
1132398043 15:101488984-101489006 CGTCGCGCGCCGTCCGCCGCTGG - Intronic
1132398267 15:101489642-101489664 CCGCGCGCGCCGCCTGCGCCCGG - Exonic
1202955295 15_KI270727v1_random:72196-72218 CCGCGCCGGCCGCCTCCCGGTGG - Intergenic
1132665427 16:1079312-1079334 CCGCTGGCGCCGCCCGCGTGTGG + Exonic
1132719686 16:1309616-1309638 CCGCGCGCCCCGCCCGCGCCAGG + Intronic
1132900451 16:2251385-2251407 CCGCCCGCTCCGTCCGCCCGAGG + Exonic
1133784382 16:8963443-8963465 CCGCCGCCGCCGCCCGCCGCGGG - Exonic
1134419304 16:14071268-14071290 CCGCGCGCGCCGCGGGGAGGAGG + Intergenic
1136146742 16:28320736-28320758 CGGCCCGCGCCCCCCGCCGTCGG + Exonic
1137748506 16:50841247-50841269 CTGCGCGCCCCGCCGGCCCGCGG - Intergenic
1137787937 16:51152479-51152501 CCCCGCTCTCCGCCCGCCCGGGG - Intergenic
1137926600 16:52546981-52547003 GCGCGCGGGCCGGGCGCCGGGGG + Exonic
1138178718 16:54928827-54928849 CCGCGCGCGCCGCCCGCCGGGGG - Intergenic
1138360693 16:56425207-56425229 CCGCGCGCTCAGCCAGCCCGAGG - Exonic
1139754581 16:69132367-69132389 CCGCGCGCCCCGCCCGGCCCCGG + Intronic
1139954303 16:70685956-70685978 TGGCCCGCGCCGCCCGCCGGAGG - Exonic
1140046122 16:71441613-71441635 GCGAGCGCGCCGGCCGCCAGGGG + Intergenic
1140478546 16:75250847-75250869 CCCCGCACGCCGAGCGCCGGTGG - Intronic
1141054838 16:80804754-80804776 CCTGGCCCGCCGCCCCCCGGGGG - Intergenic
1141132397 16:81445064-81445086 CCGCACGCGCCGCCCCCCGCGGG + Intergenic
1141526960 16:84617951-84617973 CCGAGCGCGCCCCTGGCCGGCGG + Exonic
1141841976 16:86579275-86579297 CCGCGGGCGCTGCCTGCAGGCGG - Exonic
1142509781 17:386128-386150 CCGCGCGCACCCCCCGCCCTCGG + Intronic
1142795478 17:2303782-2303804 GCGCGCGCGCCGCCCGTCTGTGG - Exonic
1142812602 17:2402137-2402159 CCCCGCGCCCCGCCCACCGCCGG - Intergenic
1143596252 17:7916018-7916040 CCCCGCGCGCCGCCAGCTCGCGG + Intergenic
1144724498 17:17495031-17495053 CCGCGCGCGCTCCCGGCCTGGGG + Exonic
1144724929 17:17496963-17496985 CCGCGCGCTCGGGCCGCCAGAGG + Intergenic
1145034924 17:19534168-19534190 CCGAGCGAGCTGTCCGCCGGCGG + Intronic
1145243594 17:21253290-21253312 CCGCGCGCCCCGGCCCCCGCCGG - Exonic
1146214894 17:30971222-30971244 GCGCCCGCGACGCCCGCCGCTGG + Exonic
1147612876 17:41811984-41812006 GCGGGCGCGCCGCCCGCCCGGGG - Exonic
1147971818 17:44222251-44222273 CCGCAGGCGCTGCCCCCCGGCGG + Intergenic
1148090344 17:45019426-45019448 CCGGGCGCCCGGCCCGCGGGAGG + Intergenic
1148271728 17:46266919-46266941 GCGCGCGCGCGGCCGGGCGGCGG - Intergenic
1148271734 17:46266930-46266952 CCGCGCGCGCGCGCCGCCGAGGG + Intergenic
1148842587 17:50508470-50508492 GCGCACGCGCCCGCCGCCGGCGG - Exonic
1151491038 17:74432449-74432471 CCCCGCCCGCCCCCCGCCTGGGG + Intronic
1152354247 17:79798997-79799019 CCTCGCGGGCCGCCCGTGGGAGG + Intronic
1152809544 17:82375071-82375093 GCGCGCGCGCCCCCGGCCGCCGG - Exonic
1152834393 17:82519928-82519950 CCGGCCCCGCCGCCCGCGGGTGG - Exonic
1153480623 18:5543479-5543501 CCGCGCTCGCCCCCAGCCCGAGG + Intronic
1153688450 18:7568084-7568106 CCGTCCGCTCCGCCCGCCCGAGG - Intronic
1153911262 18:9708295-9708317 TCGCTCGCGCCGCCCGCGGGCGG - Exonic
1154133003 18:11752008-11752030 CCGAGCGCGCCGCCCCCTCGGGG + Intronic
1154448076 18:14450662-14450684 CCGCGCCGGCCGCCTCCCGGTGG - Intergenic
1157446336 18:47749278-47749300 CGGCGCGCGGCGGCCGCCAGGGG - Intergenic
1158962256 18:62596666-62596688 CCGGGCGCACCGCCCTCCAGGGG + Intergenic
1160164039 18:76495082-76495104 CCGCGCCCACCGCCCGCCCGCGG + Intronic
1160499873 18:79396306-79396328 GGGCCCGCGCCGCGCGCCGGCGG + Exonic
1160613950 18:80109701-80109723 CGGCCCGCCCCGCCCGCCGCCGG + Intronic
1160725407 19:616072-616094 CCTCGTGCGCCGCCCGCCCCCGG + Exonic
1160736125 19:663153-663175 CCCCGCGCGGCACCCGCCGCCGG + Exonic
1160859061 19:1230077-1230099 CTGCCCGCGCCGCGCTCCGGGGG + Exonic
1161069107 19:2251644-2251666 CAGCGCGCACGGCCCGTCGGCGG - Exonic
1161388098 19:4007637-4007659 GCGCGCGCTCCTCCCGCCGCCGG - Exonic
1162758445 19:12874271-12874293 CCCCGCGCGACGACCCCCGGTGG + Exonic
1162914186 19:13865484-13865506 CCGCGCCCCCTGCCCGCGGGCGG - Intronic
1162951338 19:14073528-14073550 GCGCCAGCGCCGCCTGCCGGTGG - Exonic
1163282221 19:16324977-16324999 CCGCGAGCGCGGCCTGCAGGAGG + Exonic
1164658563 19:29942422-29942444 CCGCGCGCCCCGCGCCCAGGAGG - Exonic
1164992107 19:32692060-32692082 TCGCGCCCGCCGCCGGCCGAGGG + Exonic
1165448294 19:35868727-35868749 CTGCGCGCGCAGCCCGCCATCGG + Exonic
1166564340 19:43754596-43754618 CGGAGCGCCCCGCCCGCCGCCGG + Intronic
1167293232 19:48635720-48635742 CCCAGCCCGCCGCCCCCCGGTGG - Exonic
1167643807 19:50695339-50695361 TCGCGCCCGCCGCCCGCCTCCGG - Intronic
1168297329 19:55383802-55383824 GCGCCCCCGCCGCCCGCCGCCGG - Exonic
1168495012 19:56840540-56840562 CCCCGCGCGCCTCCTGCCCGCGG - Intronic
926581437 2:14634964-14634986 CCACGCGCGTCCGCCGCCGGTGG + Exonic
927168828 2:20351229-20351251 GCGCCCGCGCCGCCCACCGTGGG + Intronic
928606425 2:32947854-32947876 TCGCGCGCACCGCCCGCGGAGGG + Intronic
929075486 2:38076226-38076248 CGGCGCGCCCCGCCCCCCGCAGG - Intronic
929174210 2:38960442-38960464 CCGCGTGCGCCGCCAGCCGACGG + Exonic
931614585 2:64143826-64143848 CCGCGCGCCCCGCTCCCGGGCGG + Intronic
933886155 2:86720555-86720577 CCTCCCGCGCCGCCCGCTTGGGG + Exonic
933924026 2:87076151-87076173 CCTCCCGCGCCGCCCGCTTGGGG - Intergenic
934529659 2:95077077-95077099 CTGAGCGCGCCGCCAGCCCGAGG + Intergenic
934754627 2:96816555-96816577 CAGCGCGCGCCACTCGCCCGCGG - Exonic
935196550 2:100819949-100819971 CCGCGCGCGCCGCAGGCAGACGG - Intergenic
940650474 2:156436119-156436141 CCTCGCTCGCCGCCCGCTGTTGG + Intronic
942459105 2:176157416-176157438 CCGCGCCCGCCGGGGGCCGGGGG - Intronic
946431189 2:219628038-219628060 CCGCGCGCGCCGATCACCTGGGG - Exonic
947435457 2:230068518-230068540 CCGCGCGCGCCGCGGGCCTGGGG - Intronic
948473628 2:238203093-238203115 CCTTGCGCGTCGCCCGCCCGCGG - Intronic
1168800841 20:642458-642480 CCGCCCTCGCCTCCCGCAGGGGG - Intergenic
1169074340 20:2752029-2752051 CCGCGGGCGCCGCGTGCTGGGGG - Intronic
1172118436 20:32584541-32584563 GCGCGCGCGGCGGCCGCGGGCGG - Intronic
1173210724 20:41029362-41029384 CCGCGCGCGCTCGCCGCCGGAGG + Intronic
1173494333 20:43507865-43507887 CAGCCCGCGCCCCCCGCCGGAGG - Intronic
1174216759 20:48921839-48921861 TCGCTCACGCCGCCCGCCCGCGG + Intergenic
1174475759 20:50794877-50794899 CAGCGCGCGCCGCTCGCCACTGG + Exonic
1174804604 20:53594217-53594239 CCGGACGCGCCGCGCCCCGGCGG - Intronic
1175561275 20:59933157-59933179 CTGCGCGCGTCGCCGGCCCGAGG - Intronic
1176125276 20:63472273-63472295 GCGCCCGCGCCGCCCGCGCGAGG + Exonic
1176194575 20:63831304-63831326 GCGCGCGCGCGCCCCGCCCGCGG + Intergenic
1176194799 20:63831935-63831957 CCGCGCGCGCCTACCCTCGGGGG + Intergenic
1176679681 21:9812766-9812788 TCGCGGCCGCCGCCCGGCGGTGG - Intergenic
1179496952 21:41778181-41778203 CCGCCTGCGCCCCCCGCCGGGGG + Intergenic
1179496956 21:41778191-41778213 CCGGGCGTGCCCCCCGGCGGGGG - Intergenic
1179511864 21:41878921-41878943 TCGCGCCCCCCGCCCGCCCGCGG - Intronic
1180068226 21:45423490-45423512 CCCCGCCCCCCGCCCCCCGGAGG + Intronic
1180949439 22:19714561-19714583 CCCCGCACGTCCCCCGCCGGCGG + Exonic
1184680792 22:46071341-46071363 CCGCGCGCGCCGTCCCGGGGTGG + Intronic
952241367 3:31533461-31533483 CCGGGCGCGCCCCCTGCCCGTGG + Intronic
958638542 3:96776880-96776902 CCGCGGGCCGCGCCCGCCGCCGG + Intergenic
958641564 3:96813585-96813607 CCGCGCGAGCCGCCCCCTCGCGG - Intergenic
958692110 3:97481547-97481569 CCGGACGCGCCGCGCCCCGGCGG - Intronic
961012916 3:123448133-123448155 CCGCCGCCGCCGCCCGCAGGGGG + Exonic
961858277 3:129893762-129893784 GCGCGTGCGCCGCCGGCCGGGGG - Intergenic
962222299 3:133573990-133574012 CCGCGGGCCGCGCCCGCCGCCGG + Exonic
962498388 3:135965639-135965661 CCGGGCGGGCCGGCCGCCGAGGG + Intergenic
964622590 3:158732220-158732242 CCGCGCGCGCCGCCTGCTGCAGG + Exonic
965558079 3:170037909-170037931 CGGAGGGCGCCGCCTGCCGGCGG - Exonic
966378693 3:179322885-179322907 CGGCCCGCGCCCCCTGCCGGAGG - Intergenic
966594321 3:181712327-181712349 GCGCGGGCCCGGCCCGCCGGCGG - Exonic
966808641 3:183825207-183825229 CCGCGGGCGCCGGGCGCAGGTGG + Exonic
966883264 3:184361612-184361634 GCGCCAGCGGCGCCCGCCGGGGG - Exonic
967055208 3:185824684-185824706 CGGCGGGCGGCGCCCGGCGGCGG - Intronic
967904070 3:194486698-194486720 CAGCGCGCGGCGCCGGCCGAGGG - Intronic
968081552 3:195849852-195849874 CTGCGCGCGCCCCCTGCCGGCGG - Intergenic
968691532 4:1992688-1992710 CCGCGAGCGCCGCCTCCTGGTGG + Intronic
969285662 4:6200525-6200547 CGGCGCGTGCCGCACGCGGGTGG + Exonic
969571339 4:8010429-8010451 CCGAGCCCGCCGCCCGCTGCAGG - Intronic
970456070 4:16226055-16226077 CTGCGCGCGCAACCCGCCCGAGG + Intronic
971257888 4:25030728-25030750 CCGAGCGCGCGGCGCGGCGGTGG - Exonic
972533185 4:39978035-39978057 CCGCGCGGGGCGCCTCCCGGAGG + Intergenic
973945236 4:55948758-55948780 CCGCGGGCGCCGACCTCCAGGGG + Intergenic
975683393 4:76897511-76897533 CCCCGCGAGGCGCGCGCCGGGGG - Exonic
976199105 4:82561821-82561843 CCCCGTGCGCAGCCCGCAGGCGG - Intronic
976830272 4:89307571-89307593 CCGCGCTGGCCGCCAGGCGGAGG + Intronic
978741857 4:112145777-112145799 CCGCGAGCCCCGCCCGGCGTTGG + Intronic
980698777 4:136395590-136395612 CCCCCCGCCCCGCCCGCCGAGGG + Intergenic
981069998 4:140524421-140524443 CCTCGCGCGCCGCCCGCGAATGG - Intronic
981315509 4:143336586-143336608 CCGCGCCCGCTGCCCGTAGGCGG + Intergenic
982745676 4:159102922-159102944 CCCCGCTCCCCGCCCGCCAGCGG - Intergenic
983904704 4:173170084-173170106 CGGTGCGCGCCGCCCGCTGCCGG - Intronic
984888697 4:184473365-184473387 CAGCGCGCGAGGCCGGCCGGGGG + Intronic
984953226 4:185021324-185021346 GCGCGCGCACCGCACGCCCGCGG + Intergenic
984973516 4:185210234-185210256 AGCCGCCCGCCGCCCGCCGGGGG + Intronic
985644632 5:1079104-1079126 CCGCGGGCCCAGCCTGCCGGCGG + Intronic
985696759 5:1345186-1345208 CCGCCCGCGCCGCCCTCCTGGGG + Intergenic
986608503 5:9545775-9545797 CCGAGCGCGCGGCCAACCGGTGG + Exonic
989812591 5:45695948-45695970 CCGGCCCCGCCGCCCCCCGGCGG + Exonic
993116148 5:83722205-83722227 CCGCCCGCGCCGCCCCGCCGGGG - Intergenic
993900907 5:93584062-93584084 CCGCGCGCCCTGATCGCCGGCGG + Exonic
996056513 5:118988553-118988575 CAGCGCGTGGCGCCCCCCGGCGG - Intergenic
997564211 5:134874674-134874696 CCCCGCGCACCGCCCGCTGGTGG + Intronic
998286867 5:140870937-140870959 ATGCGCGAGCCGCCCGCCGCCGG - Exonic
998364280 5:141618814-141618836 CCGCCGTCGCCGCCCGCCGAGGG + Exonic
999462910 5:151772166-151772188 CCGCGCGCGCCTGCGGCCGTTGG - Intronic
1001035127 5:168291932-168291954 CCGCCCGCTCCTCCCGCCGCCGG - Intronic
1001396156 5:171420592-171420614 CCGCGTGCGCCCTGCGCCGGCGG + Intronic
1002189889 5:177472899-177472921 CCGGGCGCCCCGCCCACCGGGGG - Exonic
1002455913 5:179345300-179345322 CGGCGAGCGGCTCCCGCCGGCGG + Exonic
1007739654 6:44002834-44002856 CGGCGCGCGCGCCCCGTCGGCGG - Exonic
1010703238 6:79077569-79077591 CCGCCCGCCCCGCGCCCCGGCGG + Intronic
1011281125 6:85678901-85678923 CCGGGCGCGCGGCCGGCCTGCGG - Intergenic
1011640420 6:89412137-89412159 ACCTGGGCGCCGCCCGCCGGGGG - Exonic
1011640441 6:89412196-89412218 TCCCCCGCCCCGCCCGCCGGCGG + Exonic
1012912909 6:105137245-105137267 CGCCGGGCTCCGCCCGCCGGGGG - Intergenic
1013459016 6:110358004-110358026 CCGCTCCCGCCGCCCCCCGGCGG + Exonic
1015149365 6:130020298-130020320 CCGCGCGCCCCGCGAGCTGGTGG + Intronic
1015181285 6:130365453-130365475 GCGCCCGCGCAGCCCGCCAGGGG + Intergenic
1016010771 6:139135559-139135581 GCGGGCGCGCCGGGCGCCGGAGG + Exonic
1016328180 6:142926828-142926850 CCGCGCCCGGCGGCCGCCGCAGG - Intronic
1016386697 6:143536891-143536913 CCCCGCGCGCCGCGACCCGGAGG - Intronic
1017164174 6:151391646-151391668 CTGCGAGCGGCTCCCGCCGGGGG + Intergenic
1018400303 6:163414553-163414575 CCCCGCCCGCCGCCCGCCCCCGG + Intronic
1018635179 6:165854481-165854503 CCGCGAGAGCCGCCCGGAGGTGG - Intronic
1018652898 6:166006133-166006155 CCGGGCCCCCCGCCCGCCCGCGG + Intergenic
1019331434 7:462641-462663 CCGAGAGCGCCGCCCGCAGTGGG + Intergenic
1019344415 7:522355-522377 CCGCGCGCAAAACCCGCCGGCGG - Intergenic
1019381617 7:727107-727129 GCCCGCGCGCCGCCCGCCCGAGG + Exonic
1019473381 7:1232931-1232953 CCGCCCGCGCCTCCCGCCGCTGG + Exonic
1020204616 7:6105126-6105148 CAGCCGGCGCGGCCCGCCGGGGG + Intronic
1021653584 7:22854117-22854139 CCTCGCGCGCCCCCTGTCGGCGG - Intergenic
1021828009 7:24573636-24573658 CCGCGCGCCGGGCCGGCCGGGGG + Intronic
1022923262 7:35037189-35037211 CCCGGCGCGCCGCCCGCCGGGGG - Intronic
1026765017 7:73154958-73154980 CGGCGCGCGGCGCCCGGCGCGGG - Intergenic
1027041489 7:74964713-74964735 CGGCGCGCGGCGCCCGGCGCGGG - Intergenic
1027082153 7:75237656-75237678 CGGCGCGCGGCGCCCGGCGCGGG + Intergenic
1027773976 7:82443189-82443211 CGGTGCGCGCCGCTCGCCGCTGG - Intronic
1028622186 7:92836653-92836675 CCGCCCGCGCCGCTCGCTGGGGG + Intergenic
1028709377 7:93890461-93890483 CCGCGCGCTCCGCTGGCAGGGGG - Intronic
1029640698 7:101817233-101817255 CCGCGATCGCCGCGCGCCTGGGG + Intronic
1030033320 7:105388488-105388510 CCCCCCGGGCCGCCCGCCGGGGG + Intronic
1030215960 7:107044489-107044511 CCGGGCGCGCAGCCCTGCGGTGG + Intergenic
1031406865 7:121396389-121396411 CCGCGCCCGCCCCCTGGCGGTGG + Intergenic
1031966526 7:128031571-128031593 CCCCGCGTGCCGGCAGCCGGCGG - Intronic
1031966550 7:128031651-128031673 CCGCGCGCTCCTCCGGCCGGCGG - Intronic
1034418705 7:150978124-150978146 GAGCGCGAGCCGCCCGCCGCCGG + Exonic
1035432171 7:158830060-158830082 GAGAGGGCGCCGCCCGCCGGAGG + Intronic
1037390511 8:18387236-18387258 CCCCGCGCTCCTCCCGCTGGCGG + Intergenic
1038761178 8:30384973-30384995 CAGCCCGCGGCGCCCGCCCGAGG + Exonic
1039493655 8:37965627-37965649 GCGCGCGGGCCGCCGGCCGCAGG + Exonic
1041108000 8:54459657-54459679 CCGCGCCCGCCGCCCGCCCCGGG - Exonic
1041109396 8:54470485-54470507 CCGCGCGCGCCGCCCGCCAAGGG - Intergenic
1041690086 8:60679360-60679382 CCGCGCGCCCCCGCCGCCGCCGG - Intronic
1042020592 8:64369457-64369479 CGGCGCGCTCCGCCCGCCCGCGG - Intergenic
1042137406 8:65645129-65645151 CCGCGCCGGCCGCCAGGCGGCGG + Intronic
1043388226 8:79768224-79768246 CCGCACGCGCCGCGGGCCGTGGG + Intergenic
1043388314 8:79768523-79768545 CAGCGCGCGCCTCCAGCCGCCGG - Intergenic
1045098940 8:98825876-98825898 CCGCGCCGGCCGCCAGCCTGCGG + Intronic
1049647084 8:143740297-143740319 CCGCGCGCGCCGCCCTCAGGTGG + Intergenic
1053050626 9:34958274-34958296 CCGCCCGCGCCGCCTGCTGCCGG + Intronic
1053149204 9:35732201-35732223 CCCAGGGCGCCGCCCGCGGGTGG - Exonic
1057146953 9:92764879-92764901 CAGCGGGCCCCGCGCGCCGGAGG - Intergenic
1057146958 9:92764883-92764905 CGGCGCGCGGGGCCCGCTGGGGG + Intergenic
1057432130 9:95004645-95004667 GGGCCCGCGCCGCCCGCCGCAGG - Intronic
1057432256 9:95005002-95005024 CCGCGCCCTGCGCCCGCCCGGGG - Intronic
1057773249 9:97984727-97984749 CGGCGCGCGGCTCCCGCCAGTGG - Intronic
1059633953 9:116154384-116154406 CCGTGCGCGTCCCCCGGCGGCGG + Exonic
1060139977 9:121201525-121201547 CCCGGGGCGCCGCCCGCCTGCGG + Intronic
1060849261 9:126860884-126860906 CCGCGCCGGCCGCCTGCCCGCGG - Intronic
1060945832 9:127568997-127569019 CCGCTCCCGCCGCCCGGCTGCGG + Exonic
1060945959 9:127569287-127569309 CCCTGTGCCCCGCCCGCCGGAGG - Intronic
1061000527 9:127899695-127899717 CCGCCCGCGCCGCCCGTGGGCGG - Intronic
1062491640 9:136807871-136807893 CCGCGCGCGCCGCGCCCCCGCGG + Intergenic
1062574611 9:137200371-137200393 CCGCCCGCGCCGCCCGCCCCGGG - Exonic
1062689718 9:137834958-137834980 CCGAGCGCCCCGCTGGCCGGCGG - Exonic
1062718669 9:138023592-138023614 CCGCGCGCGCCGCTCGCCCTTGG - Exonic
1189821326 X:44872779-44872801 CCGCTCGCGCCCGCCGCGGGCGG + Intergenic
1190114920 X:47620043-47620065 TGGCGCGCGCCGCCAGGCGGGGG + Intergenic
1190390031 X:49922733-49922755 CCGAGCGCGCTGCCCACCGGCGG + Exonic
1198683278 X:139203979-139204001 GCGTGCGCGCCGCCCTCCGGCGG - Intronic
1199772742 X:150984408-150984430 CCGCCCGCGCCGGCCGCGCGCGG + Intronic
1200092965 X:153644332-153644354 GCGCGCTCGCTGCCCGCCGCAGG - Intronic