ID: 1138182365

View in Genome Browser
Species Human (GRCh38)
Location 16:54950161-54950183
Sequence TCTGCAGCTCATCCTCGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138182365_1138182370 15 Left 1138182365 16:54950161-54950183 CCCCACCGAGGATGAGCTGCAGA No data
Right 1138182370 16:54950199-54950221 CCCCTGCCTAGAAGAGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138182365 Original CRISPR TCTGCAGCTCATCCTCGGTG GGG (reversed) Intergenic
No off target data available for this crispr