ID: 1138183601

View in Genome Browser
Species Human (GRCh38)
Location 16:54959886-54959908
Sequence GACATTAATTCCCCTCCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138183599_1138183601 -5 Left 1138183599 16:54959868-54959890 CCTTCTCCAGGTTTTATTGACAT No data
Right 1138183601 16:54959886-54959908 GACATTAATTCCCCTCCTGATGG No data
1138183597_1138183601 25 Left 1138183597 16:54959838-54959860 CCTGGCTTTAGGAGTTTCAGTTT No data
Right 1138183601 16:54959886-54959908 GACATTAATTCCCCTCCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138183601 Original CRISPR GACATTAATTCCCCTCCTGA TGG Intergenic
No off target data available for this crispr