ID: 1138186882 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:54983722-54983744 |
Sequence | TGGACTCCCCCAGAAGGCAG CGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1138186877_1138186882 | 6 | Left | 1138186877 | 16:54983693-54983715 | CCTGCGCTTGCGAGGGATGCCTT | No data | ||
Right | 1138186882 | 16:54983722-54983744 | TGGACTCCCCCAGAAGGCAGCGG | No data | ||||
1138186875_1138186882 | 13 | Left | 1138186875 | 16:54983686-54983708 | CCAGGTTCCTGCGCTTGCGAGGG | No data | ||
Right | 1138186882 | 16:54983722-54983744 | TGGACTCCCCCAGAAGGCAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1138186882 | Original CRISPR | TGGACTCCCCCAGAAGGCAG CGG | Intergenic | ||