ID: 1138186882

View in Genome Browser
Species Human (GRCh38)
Location 16:54983722-54983744
Sequence TGGACTCCCCCAGAAGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138186877_1138186882 6 Left 1138186877 16:54983693-54983715 CCTGCGCTTGCGAGGGATGCCTT No data
Right 1138186882 16:54983722-54983744 TGGACTCCCCCAGAAGGCAGCGG No data
1138186875_1138186882 13 Left 1138186875 16:54983686-54983708 CCAGGTTCCTGCGCTTGCGAGGG No data
Right 1138186882 16:54983722-54983744 TGGACTCCCCCAGAAGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138186882 Original CRISPR TGGACTCCCCCAGAAGGCAG CGG Intergenic