ID: 1138187473

View in Genome Browser
Species Human (GRCh38)
Location 16:54987465-54987487
Sequence CAGAAGAACCCCAAAAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138187466_1138187473 16 Left 1138187466 16:54987426-54987448 CCAATTCTCCAGGATGTTGCTAA No data
Right 1138187473 16:54987465-54987487 CAGAAGAACCCCAAAAGGCCTGG No data
1138187467_1138187473 8 Left 1138187467 16:54987434-54987456 CCAGGATGTTGCTAAACTGCCAG No data
Right 1138187473 16:54987465-54987487 CAGAAGAACCCCAAAAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138187473 Original CRISPR CAGAAGAACCCCAAAAGGCC TGG Intergenic
No off target data available for this crispr