ID: 1138189044

View in Genome Browser
Species Human (GRCh38)
Location 16:54999358-54999380
Sequence CACGCTGCACAGATGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138189037_1138189044 14 Left 1138189037 16:54999321-54999343 CCCATGTTTGTCAAGAAGGGCTA No data
Right 1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG No data
1138189038_1138189044 13 Left 1138189038 16:54999322-54999344 CCATGTTTGTCAAGAAGGGCTAC No data
Right 1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG No data
1138189036_1138189044 15 Left 1138189036 16:54999320-54999342 CCCCATGTTTGTCAAGAAGGGCT No data
Right 1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138189044 Original CRISPR CACGCTGCACAGATGGAGGC TGG Intergenic
No off target data available for this crispr