ID: 1138189553

View in Genome Browser
Species Human (GRCh38)
Location 16:55003390-55003412
Sequence CAGCTGGGGACTGTATGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138189553_1138189561 24 Left 1138189553 16:55003390-55003412 CCTCTTCATACAGTCCCCAGCTG No data
Right 1138189561 16:55003437-55003459 TGTTGTATGACAAACACCTGAGG No data
1138189553_1138189559 -3 Left 1138189553 16:55003390-55003412 CCTCTTCATACAGTCCCCAGCTG No data
Right 1138189559 16:55003410-55003432 CTGGCAATGCTCAGTGGACCTGG No data
1138189553_1138189563 26 Left 1138189553 16:55003390-55003412 CCTCTTCATACAGTCCCCAGCTG No data
Right 1138189563 16:55003439-55003461 TTGTATGACAAACACCTGAGGGG No data
1138189553_1138189556 -9 Left 1138189553 16:55003390-55003412 CCTCTTCATACAGTCCCCAGCTG No data
Right 1138189556 16:55003404-55003426 CCCCAGCTGGCAATGCTCAGTGG No data
1138189553_1138189562 25 Left 1138189553 16:55003390-55003412 CCTCTTCATACAGTCCCCAGCTG No data
Right 1138189562 16:55003438-55003460 GTTGTATGACAAACACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138189553 Original CRISPR CAGCTGGGGACTGTATGAAG AGG (reversed) Intergenic
No off target data available for this crispr