ID: 1138189555

View in Genome Browser
Species Human (GRCh38)
Location 16:55003404-55003426
Sequence CCACTGAGCATTGCCAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138189555_1138189566 29 Left 1138189555 16:55003404-55003426 CCCCAGCTGGCAATGCTCAGTGG No data
Right 1138189566 16:55003456-55003478 GAGGGGATATTATCATCAGAGGG No data
1138189555_1138189565 28 Left 1138189555 16:55003404-55003426 CCCCAGCTGGCAATGCTCAGTGG No data
Right 1138189565 16:55003455-55003477 TGAGGGGATATTATCATCAGAGG No data
1138189555_1138189563 12 Left 1138189555 16:55003404-55003426 CCCCAGCTGGCAATGCTCAGTGG No data
Right 1138189563 16:55003439-55003461 TTGTATGACAAACACCTGAGGGG No data
1138189555_1138189562 11 Left 1138189555 16:55003404-55003426 CCCCAGCTGGCAATGCTCAGTGG No data
Right 1138189562 16:55003438-55003460 GTTGTATGACAAACACCTGAGGG No data
1138189555_1138189561 10 Left 1138189555 16:55003404-55003426 CCCCAGCTGGCAATGCTCAGTGG No data
Right 1138189561 16:55003437-55003459 TGTTGTATGACAAACACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138189555 Original CRISPR CCACTGAGCATTGCCAGCTG GGG (reversed) Intergenic
No off target data available for this crispr