ID: 1138189558

View in Genome Browser
Species Human (GRCh38)
Location 16:55003406-55003428
Sequence GTCCACTGAGCATTGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138189558_1138189567 30 Left 1138189558 16:55003406-55003428 CCAGCTGGCAATGCTCAGTGGAC No data
Right 1138189567 16:55003459-55003481 GGGATATTATCATCAGAGGGTGG No data
1138189558_1138189561 8 Left 1138189558 16:55003406-55003428 CCAGCTGGCAATGCTCAGTGGAC No data
Right 1138189561 16:55003437-55003459 TGTTGTATGACAAACACCTGAGG No data
1138189558_1138189563 10 Left 1138189558 16:55003406-55003428 CCAGCTGGCAATGCTCAGTGGAC No data
Right 1138189563 16:55003439-55003461 TTGTATGACAAACACCTGAGGGG No data
1138189558_1138189565 26 Left 1138189558 16:55003406-55003428 CCAGCTGGCAATGCTCAGTGGAC No data
Right 1138189565 16:55003455-55003477 TGAGGGGATATTATCATCAGAGG No data
1138189558_1138189566 27 Left 1138189558 16:55003406-55003428 CCAGCTGGCAATGCTCAGTGGAC No data
Right 1138189566 16:55003456-55003478 GAGGGGATATTATCATCAGAGGG No data
1138189558_1138189562 9 Left 1138189558 16:55003406-55003428 CCAGCTGGCAATGCTCAGTGGAC No data
Right 1138189562 16:55003438-55003460 GTTGTATGACAAACACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138189558 Original CRISPR GTCCACTGAGCATTGCCAGC TGG (reversed) Intergenic
No off target data available for this crispr