ID: 1138189563

View in Genome Browser
Species Human (GRCh38)
Location 16:55003439-55003461
Sequence TTGTATGACAAACACCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138189553_1138189563 26 Left 1138189553 16:55003390-55003412 CCTCTTCATACAGTCCCCAGCTG No data
Right 1138189563 16:55003439-55003461 TTGTATGACAAACACCTGAGGGG No data
1138189558_1138189563 10 Left 1138189558 16:55003406-55003428 CCAGCTGGCAATGCTCAGTGGAC No data
Right 1138189563 16:55003439-55003461 TTGTATGACAAACACCTGAGGGG No data
1138189555_1138189563 12 Left 1138189555 16:55003404-55003426 CCCCAGCTGGCAATGCTCAGTGG No data
Right 1138189563 16:55003439-55003461 TTGTATGACAAACACCTGAGGGG No data
1138189557_1138189563 11 Left 1138189557 16:55003405-55003427 CCCAGCTGGCAATGCTCAGTGGA No data
Right 1138189563 16:55003439-55003461 TTGTATGACAAACACCTGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138189563 Original CRISPR TTGTATGACAAACACCTGAG GGG Intergenic
No off target data available for this crispr