ID: 1138190088

View in Genome Browser
Species Human (GRCh38)
Location 16:55007635-55007657
Sequence CTGGCGAAGGGGGTATTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138190068_1138190088 24 Left 1138190068 16:55007588-55007610 CCAACCCTTGCTGGGACCCATGG No data
Right 1138190088 16:55007635-55007657 CTGGCGAAGGGGGTATTGATGGG No data
1138190072_1138190088 20 Left 1138190072 16:55007592-55007614 CCCTTGCTGGGACCCATGGGGCA No data
Right 1138190088 16:55007635-55007657 CTGGCGAAGGGGGTATTGATGGG No data
1138190073_1138190088 19 Left 1138190073 16:55007593-55007615 CCTTGCTGGGACCCATGGGGCAG No data
Right 1138190088 16:55007635-55007657 CTGGCGAAGGGGGTATTGATGGG No data
1138190078_1138190088 7 Left 1138190078 16:55007605-55007627 CCATGGGGCAGAGAAGGGGATTG No data
Right 1138190088 16:55007635-55007657 CTGGCGAAGGGGGTATTGATGGG No data
1138190077_1138190088 8 Left 1138190077 16:55007604-55007626 CCCATGGGGCAGAGAAGGGGATT No data
Right 1138190088 16:55007635-55007657 CTGGCGAAGGGGGTATTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138190088 Original CRISPR CTGGCGAAGGGGGTATTGAT GGG Intergenic
No off target data available for this crispr