ID: 1138190387

View in Genome Browser
Species Human (GRCh38)
Location 16:55009446-55009468
Sequence CTGGGGGTGTGGCAGTCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138190376_1138190387 11 Left 1138190376 16:55009412-55009434 CCAAGTGACATGTCTTTCCAGGC No data
Right 1138190387 16:55009446-55009468 CTGGGGGTGTGGCAGTCACAGGG No data
1138190381_1138190387 -6 Left 1138190381 16:55009429-55009451 CCAGGCACTGAGCCGGGCTGGGG No data
Right 1138190387 16:55009446-55009468 CTGGGGGTGTGGCAGTCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138190387 Original CRISPR CTGGGGGTGTGGCAGTCACA GGG Intergenic
No off target data available for this crispr