ID: 1138193014

View in Genome Browser
Species Human (GRCh38)
Location 16:55032063-55032085
Sequence AACGTGACCACACGTTGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138193010_1138193014 8 Left 1138193010 16:55032032-55032054 CCACGATCTGAACCCAGAGTGCG No data
Right 1138193014 16:55032063-55032085 AACGTGACCACACGTTGAGTGGG No data
1138193008_1138193014 28 Left 1138193008 16:55032012-55032034 CCAGCCAGAGCTAGGCAGAGCCA No data
Right 1138193014 16:55032063-55032085 AACGTGACCACACGTTGAGTGGG No data
1138193012_1138193014 -5 Left 1138193012 16:55032045-55032067 CCAGAGTGCGTGCTTTTGAACGT No data
Right 1138193014 16:55032063-55032085 AACGTGACCACACGTTGAGTGGG No data
1138193009_1138193014 24 Left 1138193009 16:55032016-55032038 CCAGAGCTAGGCAGAGCCACGAT No data
Right 1138193014 16:55032063-55032085 AACGTGACCACACGTTGAGTGGG No data
1138193011_1138193014 -4 Left 1138193011 16:55032044-55032066 CCCAGAGTGCGTGCTTTTGAACG No data
Right 1138193014 16:55032063-55032085 AACGTGACCACACGTTGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138193014 Original CRISPR AACGTGACCACACGTTGAGT GGG Intergenic
No off target data available for this crispr