ID: 1138193246

View in Genome Browser
Species Human (GRCh38)
Location 16:55033688-55033710
Sequence CTTCCACGGGGAGCGCCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138193237_1138193246 -5 Left 1138193237 16:55033670-55033692 CCCGGCCTCTCCTTAACCCTTCC No data
Right 1138193246 16:55033688-55033710 CTTCCACGGGGAGCGCCTGCCGG No data
1138193240_1138193246 -10 Left 1138193240 16:55033675-55033697 CCTCTCCTTAACCCTTCCACGGG No data
Right 1138193246 16:55033688-55033710 CTTCCACGGGGAGCGCCTGCCGG No data
1138193235_1138193246 8 Left 1138193235 16:55033657-55033679 CCAGAATGTGCCGCCCGGCCTCT No data
Right 1138193246 16:55033688-55033710 CTTCCACGGGGAGCGCCTGCCGG No data
1138193236_1138193246 -2 Left 1138193236 16:55033667-55033689 CCGCCCGGCCTCTCCTTAACCCT No data
Right 1138193246 16:55033688-55033710 CTTCCACGGGGAGCGCCTGCCGG No data
1138193238_1138193246 -6 Left 1138193238 16:55033671-55033693 CCGGCCTCTCCTTAACCCTTCCA No data
Right 1138193246 16:55033688-55033710 CTTCCACGGGGAGCGCCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138193246 Original CRISPR CTTCCACGGGGAGCGCCTGC CGG Intergenic
No off target data available for this crispr