ID: 1138195151

View in Genome Browser
Species Human (GRCh38)
Location 16:55046460-55046482
Sequence GGCTGGACACAATTGAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138195151_1138195160 27 Left 1138195151 16:55046460-55046482 CCAGCTTTCAATTGTGTCCAGCC No data
Right 1138195160 16:55046510-55046532 GAGGTTTTTAATAATCAGTAAGG No data
1138195151_1138195159 8 Left 1138195151 16:55046460-55046482 CCAGCTTTCAATTGTGTCCAGCC No data
Right 1138195159 16:55046491-55046513 CAGTGAGATTCAGTACGTGGAGG No data
1138195151_1138195158 5 Left 1138195151 16:55046460-55046482 CCAGCTTTCAATTGTGTCCAGCC No data
Right 1138195158 16:55046488-55046510 CCACAGTGAGATTCAGTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138195151 Original CRISPR GGCTGGACACAATTGAAAGC TGG (reversed) Intergenic
No off target data available for this crispr