ID: 1138196461

View in Genome Browser
Species Human (GRCh38)
Location 16:55055723-55055745
Sequence TCTGAGGAGGAGCCACTAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138196461_1138196465 -8 Left 1138196461 16:55055723-55055745 CCAACTAGTGGCTCCTCCTCAGA No data
Right 1138196465 16:55055738-55055760 TCCTCAGAGGTCTGGATCCCTGG No data
1138196461_1138196468 0 Left 1138196461 16:55055723-55055745 CCAACTAGTGGCTCCTCCTCAGA No data
Right 1138196468 16:55055746-55055768 GGTCTGGATCCCTGGCCCATGGG No data
1138196461_1138196469 1 Left 1138196461 16:55055723-55055745 CCAACTAGTGGCTCCTCCTCAGA No data
Right 1138196469 16:55055747-55055769 GTCTGGATCCCTGGCCCATGGGG No data
1138196461_1138196467 -1 Left 1138196461 16:55055723-55055745 CCAACTAGTGGCTCCTCCTCAGA No data
Right 1138196467 16:55055745-55055767 AGGTCTGGATCCCTGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138196461 Original CRISPR TCTGAGGAGGAGCCACTAGT TGG (reversed) Intergenic
No off target data available for this crispr