ID: 1138197825

View in Genome Browser
Species Human (GRCh38)
Location 16:55066682-55066704
Sequence ACCTCCGCCAACATTTGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138197825_1138197829 13 Left 1138197825 16:55066682-55066704 CCACACCAAATGTTGGCGGAGGT No data
Right 1138197829 16:55066718-55066740 AACTCTAATACAGCGCTGGTTGG No data
1138197825_1138197830 25 Left 1138197825 16:55066682-55066704 CCACACCAAATGTTGGCGGAGGT No data
Right 1138197830 16:55066730-55066752 GCGCTGGTTGGAAAGTAAAATGG No data
1138197825_1138197828 9 Left 1138197825 16:55066682-55066704 CCACACCAAATGTTGGCGGAGGT No data
Right 1138197828 16:55066714-55066736 CTTGAACTCTAATACAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138197825 Original CRISPR ACCTCCGCCAACATTTGGTG TGG (reversed) Intergenic
No off target data available for this crispr