ID: 1138197828

View in Genome Browser
Species Human (GRCh38)
Location 16:55066714-55066736
Sequence CTTGAACTCTAATACAGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138197825_1138197828 9 Left 1138197825 16:55066682-55066704 CCACACCAAATGTTGGCGGAGGT No data
Right 1138197828 16:55066714-55066736 CTTGAACTCTAATACAGCGCTGG No data
1138197827_1138197828 4 Left 1138197827 16:55066687-55066709 CCAAATGTTGGCGGAGGTGTGGA No data
Right 1138197828 16:55066714-55066736 CTTGAACTCTAATACAGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138197828 Original CRISPR CTTGAACTCTAATACAGCGC TGG Intergenic
No off target data available for this crispr