ID: 1138198753

View in Genome Browser
Species Human (GRCh38)
Location 16:55073683-55073705
Sequence CAGGAGCAGGATTCAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138198740_1138198753 27 Left 1138198740 16:55073633-55073655 CCACTGGAGTAAATCCAGGAGGC No data
Right 1138198753 16:55073683-55073705 CAGGAGCAGGATTCAGTGGGGGG No data
1138198742_1138198753 13 Left 1138198742 16:55073647-55073669 CCAGGAGGCTGTGGCACTTCTAA No data
Right 1138198753 16:55073683-55073705 CAGGAGCAGGATTCAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138198753 Original CRISPR CAGGAGCAGGATTCAGTGGG GGG Intergenic
No off target data available for this crispr