ID: 1138201124

View in Genome Browser
Species Human (GRCh38)
Location 16:55089268-55089290
Sequence CATTTTGTTTGAGTGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138201122_1138201124 6 Left 1138201122 16:55089239-55089261 CCTTGATCTCTTGATGGTTGCAG No data
Right 1138201124 16:55089268-55089290 CATTTTGTTTGAGTGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138201124 Original CRISPR CATTTTGTTTGAGTGGCATA TGG Intergenic
No off target data available for this crispr