ID: 1138203607

View in Genome Browser
Species Human (GRCh38)
Location 16:55108034-55108056
Sequence ACAGCTCCAAAGTTAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138203607_1138203610 28 Left 1138203607 16:55108034-55108056 CCTGGCTCTAACTTTGGAGCTGT No data
Right 1138203610 16:55108085-55108107 CAGTTTCTTCACCTATACTCTGG No data
1138203607_1138203611 29 Left 1138203607 16:55108034-55108056 CCTGGCTCTAACTTTGGAGCTGT No data
Right 1138203611 16:55108086-55108108 AGTTTCTTCACCTATACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138203607 Original CRISPR ACAGCTCCAAAGTTAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr