ID: 1138206736

View in Genome Browser
Species Human (GRCh38)
Location 16:55130918-55130940
Sequence CAGCTCTTACTGGGGATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1138206725_1138206736 24 Left 1138206725 16:55130871-55130893 CCAGGAGCAGGGGGCCACCTCCC No data
Right 1138206736 16:55130918-55130940 CAGCTCTTACTGGGGATCCATGG No data
1138206731_1138206736 3 Left 1138206731 16:55130892-55130914 CCTTAGCCTCTACAGGACTTGGT No data
Right 1138206736 16:55130918-55130940 CAGCTCTTACTGGGGATCCATGG No data
1138206726_1138206736 10 Left 1138206726 16:55130885-55130907 CCACCTCCCTTAGCCTCTACAGG No data
Right 1138206736 16:55130918-55130940 CAGCTCTTACTGGGGATCCATGG No data
1138206729_1138206736 4 Left 1138206729 16:55130891-55130913 CCCTTAGCCTCTACAGGACTTGG No data
Right 1138206736 16:55130918-55130940 CAGCTCTTACTGGGGATCCATGG No data
1138206732_1138206736 -3 Left 1138206732 16:55130898-55130920 CCTCTACAGGACTTGGTGTTCAG No data
Right 1138206736 16:55130918-55130940 CAGCTCTTACTGGGGATCCATGG No data
1138206728_1138206736 7 Left 1138206728 16:55130888-55130910 CCTCCCTTAGCCTCTACAGGACT No data
Right 1138206736 16:55130918-55130940 CAGCTCTTACTGGGGATCCATGG No data
1138206724_1138206736 28 Left 1138206724 16:55130867-55130889 CCTGCCAGGAGCAGGGGGCCACC No data
Right 1138206736 16:55130918-55130940 CAGCTCTTACTGGGGATCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1138206736 Original CRISPR CAGCTCTTACTGGGGATCCA TGG Intergenic
No off target data available for this crispr